Subsequence

A subsequence is a sequence which omits some members, for instance,

is a subsequence of X where X is

, with corresponding index sequence <3,7,9,10>

Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y.

Given X as above, and

A common subsequence of X and Y could be

This would not be the longest common subsequence, since G only has length 3, and the sequence < B,E,E,B > has length 4.

It turns out the longest common subsequence of X and Y would be < B,E,G,C,E,B >

Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands.

Take two strands of DNA, say

ORG₁ = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
ORG₂ = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

A common problem in subsequences is the Longest-common subsequence problem, where we use dynamic programming to find a maximum length subsequence of two or more sequences.